{"id":1684,"date":"2017-12-27T05:39:53","date_gmt":"2017-12-27T05:39:53","guid":{"rendered":"https:\/\/www.mybiosource.com\/learn\/?page_id=1684"},"modified":"2023-03-02T12:38:33","modified_gmt":"2023-03-02T12:38:33","slug":"ribosome-profiling","status":"publish","type":"page","link":"https:\/\/www.mybiosource.com\/learn\/testing-procedures\/ribosome-profiling\/","title":{"rendered":"Ribosome Profiling"},"content":{"rendered":"

In this article two protocols have been described. The first protocol is for combined m-RNA<\/span> and ribosome<\/span> profiling. Since most of the biological procedures requires both of them done at same time. Second procedure is for the profiling of ribosome<\/span> only.<\/p>\n

Harvesting cells for parallel mRNA-Seq and ribosome profiling <\/strong><\/h3>\n

Harvesting of cells\/biological material <\/strong><\/h4>\n

The example below is written for cells grown in monolayer culture. Estimate of number of cells required:<\/p>\n

mRNA-Seq: Use enough cells to get ~15-20 \u03bcg total RNA<\/span><\/p>\n

Ribosome<\/span> profiling:<\/strong> This varies depending on cell type\/size, but as an example, use ~10 million HeLa cells per sucrose gradient<\/p>\n

Day before: <\/strong><\/p>\n

Split cells such that dish will be 70-80% confluent on day of harvesting.<\/p>\n

Day of harvesting<\/strong><\/h3>\n

Arrest translation with cycloheximide (CHX)<\/p>\n

    \n
  1. Spike medium that cells are growing in with CHX (final 100 \u03bcg\/ml, therefore NOTE the volume of media in the dish\/container beforehand!)<\/li>\n
  2. Return cells to 37 \u00b0C for 10 min.<\/li>\n<\/ol>\n

    Harvesting cells <\/strong><\/h3>\n
      \n
    1. Transport cells to cold room.<\/li>\n
    2. Remove media on ice.<\/li>\n
    3. Wash 2x with ice-cold PBS (+100 \u03bcg\/ml CHX).<\/li>\n
    4. Scrape cells off culture dish in PBS (+100 \u03bcg\/ml CHX).<\/li>\n
    5. Transfer to eppendorf tube and divide cell suspension into separate portions for mRNA-Seq and ribosome<\/span> profiling accordingly.<\/li>\n
    6. Centrifuge at 330 x g for 5 min to pellet cells.<\/li>\n
    7. Remove supernatant.<\/li>\n
    8. (a) Extract total RNA<\/span> with TRI reagent (done according to manufacturer\u2019s instructions)<\/li>\n
    9. (b) To cell pellet used for ribosome<\/span> profiling: lyse cells with 1 ml lysis buffer<\/span>. Shear 4x with 26-gauge needle, very gently.<\/li>\n<\/ol>\n

      Library generation \u2013 for mRNA-Seq and ribosome profiling <\/strong><\/h3>\n

      Size selection <\/em><\/strong><\/p>\n

      Ribosome profiling<\/em><\/strong><\/h4>\n

      Ribosome<\/span>-protected fragments (RPFs) are usually ~30 nt<\/span> in length. Previous runs have indicated that the main contaminating rRNA fragments are at ~26 nt<\/span> and ~35 nt<\/span>. Thus it is recommended to use 26-mer and 32-mer RNA<\/span> marker oligos (these would be 27 nt<\/span> and 33 nt<\/span> after pCp labeling) to follow the entire library generation process.<\/p>\n

      mRNA-Seq<\/em><\/h4>\n

      Run labeled markers alongside the samples to estimate the size range to cut.<\/p>\n

      Decade marker labeling <\/strong><\/h4>\n

      Markers according to manufacturer\u2019s instructions<\/p>\n

      pCp labeling of marker oligos (26-mer, 32-mer)<\/strong><\/p>\n\n\n\n\n\n\n\n\n\n\n
      \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 Vol<\/td>\n<\/tr>\n
      Marker oligo RNA<\/span> (10 \u03bcM)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a01.6<\/td>\n<\/tr>\n
      [5\u2032-32P]-pCp (3000 Ci\/mmol, 10 mCi\/ml)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 5<\/td>\n<\/tr>\n
      10x T4<\/span> ligation buffer<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 2<\/td>\n<\/tr>\n
      ATP<\/span> (40 \u03bcM)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 3<\/td>\n<\/tr>\n
      T4<\/span> RNA<\/span> ligase 1 (20 U\/\u03bcl, NEB)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 2<\/td>\n<\/tr>\n
      H2O<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 6.4<\/td>\n<\/tr>\n
      –> 16 \u00b0C, O\/N\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 20 \u03bcl<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

      After overnight ligation,<\/p>\n

        \n
      1. Add 20 \u03bcl 2x loading dye to ligation reaction<\/li>\n
      2. Gel-purify, elute overnight in 0.3 M NaCl, precipitate eluted RNA<\/span> with GlycoBlue<\/li>\n<\/ol>\n

        Size selection by denaturing polyacrylamide gel <\/strong><\/h3>\n

        For each sample RNA<\/span> (resuspended in H2O):<\/p>\n

          \n
        1. Add 10 K count (in total) of 26-mer and 32-mer labeled marker oligos (now 27 bases and 33 bases long respectively)<\/li>\n
        2. Add 2x loading dye<\/li>\n
        3. Run on 10% urea-polyacrylamide gel, till dye front just about reached bottom of gel.<\/li>\n
        4. For RPFs: Cut out 27\u201233 nt<\/span>, make the cut tightly around the labeled markers.<\/li>\n
        5. For mRNA-Seq fragments: Based on the labeled Decade markers, cut out a 20-base size range (e.g. I have done 25\u201245 nt<\/span>, and 35\u201255 nt<\/span>)<\/li>\n
        6. Elute overnight in 0.3 M NaCl \uf0e0 precipitate RNA<\/span> with GlycoBlue<\/li>\n<\/ol>\n

          NOTE: It is important to make the cut TIGHTLY around the RPFs to exclude as much of the flanking rRNA fragments as possible. If this cut is not tight enough, it results in in high levels of rRNA contamination (60\u201293%) in the initial RPF libraries.<\/p>\n

          Dephosphorylation<\/h3>\n

          Resuspend RNA<\/span> pellet (after size selection) in H2<\/sub>O<\/p>\n\n\n\n\n\n\n\n\n
          \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 Vol<\/td>\n<\/tr>\n
          RNA<\/span><\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a05<\/td>\n<\/tr>\n
          1.5x MES-NaOH<\/span> buffer, pH<\/span> 5.5<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 16.67<\/td>\n<\/tr>\n
          PNK (10 U\/\u03bcl, NEB)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 1.25<\/td>\n<\/tr>\n
          H2O<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 2.08<\/td>\n<\/tr>\n
          25 \u03bcl<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

          –> 37 \u00b0C, 6 hr<\/p>\n

          After 6-hr incubation, to each dephosphorylation reaction:<\/p>\n

            \n
          1. Add 5 \u03bcl H2O to top up to 30 \u03bcl<\/li>\n
          2. Desalt with G-25 microspin column<\/li>\n
          3. Top up to 400 \u03bcl with H2O<\/li>\n
          4. Add equal volume of phenol pH<\/span> 8.0, and phenol\/chloroform extract<\/li>\n
          5. To final aqueous phase, add 0.1x vol NaOAc (3 M, pH<\/span> 5.2), 2.5x vol 100% EtOH, GlycoBlue \uf0e0 precipitate<\/li>\n<\/ol>\n

            Ligation <\/strong><\/h3>\n

            Resuspend RNA<\/span> pellet (after 3\u2032 dephosphorylation) in H2O<\/p>\n\n\n\n\n\n\n\n\n\n
            \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 Vol<\/td>\n<\/tr>\n
            RNA<\/span><\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 5<\/td>\n<\/tr>\n
            3\u2032 adenylated adaptor (100 \u03bcM)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 1<\/td>\n<\/tr>\n
            10x T4<\/span> ligation buffer<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 1<\/td>\n<\/tr>\n
            T4<\/span> RNA<\/span> ligase 1 (20 U\/\u03bcl, NEB)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 1<\/td>\n<\/tr>\n
            H2O<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 2<\/td>\n<\/tr>\n
            10 \u03bcl<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

            –> 22 \u00b0C, 2.5 hr<\/p>\n

            NOTE: Do NOT use the T4<\/span> ligation buffer from NEB, which contains ATP<\/span><\/p>\n

            To each ligation reaction:<\/p>\n

              \n
            1. Add 2x loading dye<\/li>\n
            2. Gel-purify on 10% urea-polyacrylamide gel, cut out expected size range (+ 21 nt<\/span> to original size-selected fragments), using marker oligos and\/or Decade markers as guide<\/li>\n
            3. Elute overnight \u00e0 precipitate RNA<\/span> with GlycoBlue<\/li>\n<\/ol>\n

              Phosphorylation <\/strong><\/h3>\n

              Resuspend RNA<\/span> pellet (after 3\u2032 ligation) in H2O<\/p>\n\n\n\n\n\n\n\n\n\n
              Vol<\/td>\n<\/tr>\n
              RNA<\/span><\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a05<\/td>\n<\/tr>\n
              10x PNK buffer (NEB)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a01<\/td>\n<\/tr>\n
              [32P]\u03b3-ATP<\/span> (6000 Ci\/mmol, 150 mCi\/ml)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0Trace<\/td>\n<\/tr>\n
              PNK (10 U\/\u03bcl, NEB)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a01.5<\/td>\n<\/tr>\n
              H2O<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0Top up to 10<\/td>\n<\/tr>\n
              10 \u03bcl<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

              –> 37 \u00b0C, 30 min<\/p>\n

              After 30 min incubation, to each 5\u2032 phosphorylation<\/span> reaction:<\/p>\n

                \n
              1. Add 16 \u03bcl H2O to top up to 30 \u03bcl<\/li>\n
              2. Desalt with G-25 microspin column<\/li>\n
              3. Top up to 400 \u03bcl with H2O<\/li>\n
              4. Add equal volume of phenol pH<\/span> 8.0, and phenol\/chloroform extract<\/li>\n
              5. To final aqueous phase, add 0.1x vol NaOAc (3 M, pH<\/span> 5.2), 2.5x vol 100% EtOH, GlycoBlue \u00e0 precipitate<\/li>\n<\/ol>\n

                Ligation <\/strong><\/h3>\n

                Resuspend RNA<\/span> pellet (after 5\u2032 phosphorylation<\/span>) in H2O<\/p>\n\n\n\n\n\n\n\n\n\n
                Vol<\/td>\n<\/tr>\n
                RNA<\/span><\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 4.8<\/td>\n<\/tr>\n
                5\u2032 adaptor (100 \u03bcM)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 2.6<\/td>\n<\/tr>\n
                10x T4<\/span> ligation buffer<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 1<\/td>\n<\/tr>\n
                ATP<\/span> (4 mM)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 0.6<\/td>\n<\/tr>\n
                T4<\/span> RNA<\/span> ligase 1 (20 U\/\u03bcl, NEB)<\/td>\n\u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 \u00a0 1<\/td>\n<\/tr>\n
                10 \u03bcl<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                –> 22 \u00b0C, 18 hr<\/p>\n

                To each ligation reaction:<\/p>\n

                  \n
                1. Add 2x loading dye<\/li>\n
                2. Gel-purify on 10% urea-polyacrylamide gel, cut out expected size range (+ 26 nt<\/span> to the size range after 3\u2032 ligation), using marker oligos and\/or markers as guide<\/li>\n
                3. Elute overnight \u00e0 precipitate RNA<\/span> with GlycoBlue<\/li>\n<\/ol>\n

                  4.6 Reverse transcription<\/span>\/Splicing<\/span> by Overlap Extension PCR<\/span> (SOE-PCR<\/span>)<\/p>\n

                  This part of the protocol largely follows the analogous section in the Bartel lab small RNA<\/span> cloning protocol.<\/p>\n

                  Reverse transcription <\/strong><\/h3>\n

                  Resuspend RNA<\/span> pellet (after 5\u2032 ligation) in H2O<\/p>\n\n\n\n\n\n\n\n
                  Vol<\/td>\n<\/tr>\n
                  RNA<\/span><\/td>\n5<\/td>\n<\/tr>\n
                  RT primer\/5\u2032 PCR<\/span> primer (100 \u03bcM)<\/td>\n1<\/td>\n<\/tr>\n
                  H2O<\/td>\n9.6<\/td>\n<\/tr>\n
                  15.6 \u03bcl<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                  –> 48 \u00b0C, 3 min<\/p>\n

                  To each tube:<\/p>\n

                    \n
                  1. Remove 3 \u03bcl for RT-minus control<\/li>\n
                  2. Add 1 \u03bcl SuperScript II (200 U, Invitrogen) to RT-plus reaction<\/li>\n<\/ol>\n

                    –>44 \u00b0C, 1 hr<\/p>\n

                      \n
                    1. Hydrolyze RNA<\/span> template by adding 1 M NaOH<\/span><\/li>\n<\/ol>\n\n\n\n\n\n
                      RT-plus<\/td>\nRT-minus<\/td>\n<\/tr>\n
                      1 M NaOH<\/span><\/td>\n5 \u03bcl<\/td>\n0.5 \u03bcl<\/td>\n<\/tr>\n
                      <\/td>\n<\/td>\n<\/td>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                      –>90 \u00b0C, 10 min<\/p>\n

                        \n
                      1. Add 1 M HEPES-NaOH<\/span> (pH<\/span> 7.0) to neutralize<\/li>\n<\/ol>\n\n\n\n\n\n
                        RT-plus<\/td>\nRT-minus<\/td>\n<\/tr>\n
                        1 M HEPES-NaOH<\/span> (pH<\/span> 7.0)<\/td>\n25 \u03bcl<\/td>\n2.5 \u03bcl<\/td>\n<\/tr>\n
                        <\/td>\n<\/td>\n<\/td>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n
                          \n
                        1. Desalt with G-25 microspin column<\/li>\n
                        2. Proceed straight to SOE-PCR<\/span> or store at \u201220 \u00b0C<\/li>\n<\/ol>\n

                          SOE-PCR1 (to allow for extension) <\/strong><\/h3>\n\n\n\n\n\n\n\n\n\n\n\n
                          RT-plus<\/td>\nRT-minus<\/td>\n<\/tr>\n
                          RT reaction<\/td>\n8<\/td>\n4<\/td>\n<\/tr>\n
                          5x Phusion High Fidelity buffer (NEB)<\/td>\n20<\/td>\n10<\/td>\n<\/tr>\n
                          10x dNTPs<\/td>\n12.6<\/td>\n6.3<\/td>\n<\/tr>\n
                          3\u2032 PCR<\/span> primer (150 nM<\/span>)<\/td>\n2<\/td>\n1<\/td>\n<\/tr>\n
                          Phusion polymerase<\/span> (2 U\/\u03bcl, NEB)<\/td>\n1<\/td>\n0.5<\/td>\n<\/tr>\n
                          H2O<\/td>\n54.4<\/td>\n27.2<\/td>\n<\/tr>\n
                          \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 98 \u03bcl<\/td>\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 49 \u03bcl<\/td>\n<\/tr>\n
                          <\/td>\n<\/td>\n<\/td>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                          \u00e0Split RT-plus into 2 tubes of 49 \u03bcl each<\/p>\n

                          The PCR<\/span> cycle is as follows at 98oC\u00a0 for 30 sec, at 94oC for 30 sec , at 60oC for 30 sec, at 72oC for 15 sec, at 72 oC for 10 minutes , at 10oC for an indefinite time. Repeat 3 more times.<\/p>\n

                          \u00a0<\/strong>SOE-PCR2 (for amplification) <\/strong><\/h3>\n

                          To each tube of PCR<\/span> reaction, add:<\/p>\n\n\n\n\n\n\n
                          Vol<\/td>\n<\/tr>\n
                          5\u2032 PCR<\/span> primer (25 \u03bcM)<\/td>\n0.5<\/td>\n<\/tr>\n
                          3\u2032 PCR<\/span> primer (25 \u03bcM)<\/td>\n0.5<\/td>\n<\/tr>\n
                          49 + 1 = 50 \u03bcl<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                          The PCR<\/span> cycle is as follows at 980<\/sup>C\u00a0 for 30 sec, at 940<\/sup>C for 30 sec , at 600<\/sup>C for 30 sec, at 720<\/sup>C for 15 sec, at 720<\/sup>C for 10 min , at 100<\/sup>C for infinite time. For 18 cycles in total.<\/p>\n

                          Ethanol-precipitate each PCR reaction without GlycoBlue <\/strong><\/h3>\n

                          Formamide gel purification and sample submission<\/p>\n

                            \n
                          1. Resuspend each DNA<\/span> pellet in 15 \u03bcl 1x formamide loading dye<\/li>\n
                          2. Prepare 10 nt<\/span> ladder: 2 \u03bcl 10 bp DNA<\/span> marker (diluted to 0.1 \u03bcg\/\u03bcl, Invitrogen) in 13 \u03bcl 1x formamide loading dye<\/li>\n
                          3. Heat samples and marker for 10 min at 85 \u00b0C and gel-purify on 90% formamide, 8% acrylamide gel<\/li>\n
                          4. Stain with SYBR Gold (Invitrogen) (5 \u03bcl\/50 ml 1X TBE )<\/li>\n
                          5. Cut and elute band at ~100 nt<\/span> for ribosome<\/span> profiling samples. mRNA-Seq samples will run slightly higher, depending on the initial size-selection (RT-minus sample will run at ~44 nt<\/span>).<\/li>\n
                          6. Ethanol-precipitate without adding GlycoBlue.<\/li>\n
                          7. After precipitation, remove ethanol, wash once with 70% ethanol<\/li>\n
                          8. Let dry for 10 min with cap open, and another 20 min with cap closed (but poke hole in cap)<\/li>\n
                          9. Resuspend in 10 \u03bcl 10 mM Tris (EB) and submit sample for sequencing<\/li>\n<\/ol>\n

                            Buffers <\/em><\/strong><\/h3>\n
                              \n
                            1. 1.5x MES-NaOH<\/span> buffer<\/li>\n<\/ol>\n

                              150 mM MES-NaOH<\/span>, pH<\/span> 5.5<\/p>\n

                              15 mM MgCl2<\/p>\n

                              15 mM \u03b2-mercaptoethanol<\/p>\n

                              450 mM NaCl<\/p>\n

                              Store at \u201220 \u00b0C<\/p>\n

                                \n
                              1. 10x T4<\/span> ligation buffer<\/li>\n<\/ol>\n

                                500 mM Tris-HCl, pH<\/span> 7.8<\/p>\n

                                100 mM MgCl2<\/p>\n

                                100 mM DTT<\/p>\n

                                Store at \u201220 \u00b0C<\/p>\n

                                Oligo\u2019s used <\/strong><\/p>\n

                                >26-mer marker oligo<\/p>\n

                                5\u2032 AGCGUGUACUCCGAAGAGGAUCCAAA 3\u2032<\/p>\n

                                >32-mer marker oligo<\/p>\n

                                5\u2032 GGCAUUAACGCGAACUCGGCCUACAAUAGUGA 3\u2032<\/p>\n

                                >3\u2032 adenylated adaptor (21.340x)<\/p>\n

                                5\u2032 AppTCGTATGCCGTCTTCTGCTTGidT 3\u2032<\/p>\n

                                >5\u2032 adaptor (26.71)<\/p>\n

                                5\u2032 GUUCAGAGUUCUACAGUCCGACGAUC 3\u2032<\/p>\n

                                >RT primer\/5\u2032 PCR<\/span> primer (18.206)<\/p>\n

                                5\u2032 CAAGCAGAAGACGGCATA 3\u2032<\/p>\n

                                >3\u2032 PCR<\/span> primer (44.45)<\/p>\n

                                5\u2032 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA 3\u2032<\/p>\n

                                >Sequencing primer used on Solexa flow cell (underlined in final contruct)<\/p>\n

                                5\u2032 CGACAGGTTCAGAGTTCTACAGTCCGACGATC 3\u2032<\/p>\n

                                Final construct:<\/p>\n

                                5\u2032 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACGATCNNNNNNNNNNNNNTCGTATGCCGTCTTCTGCTTG 3\u2032<\/p>\n

                                3\u2032 TTACTATGCCGCTGGTGGCTGTCCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNNNNNNNAGCATACGGCAGAAGACGAAC 5\u2032<\/p>\n

                                For formulation<\/p>\n

                                Miscellaneous procedures <\/strong><\/h3>\n

                                Gel purification <\/strong><\/h4>\n

                                To each sample RNA<\/span>:<\/p>\n

                                  \n
                                1. Add 2x loading dye<\/li>\n
                                2. Heat to 90 \u00b0C for 5 min<\/li>\n
                                3. Run on a 10% denaturing polyacrylamide gel until dye front about ~1 inch from bottom<\/li>\n
                                4. Cut out gel piece containing RNA<\/span> of desired size range<\/li>\n
                                5. Elute RNA<\/span> from the gel piece by adding 440 \u03bcl 0.3 M NaCl, and rotating the tube at 4 \u00b0C overnight<\/li>\n
                                6. (Next day) Remove supernatant (~400 \u03bcl) and add 1 ml 100% ethanol (optional: add GlycoBlue to help visualize RNA<\/span> pellet after precipitation<\/li>\n
                                7. Precipitate at \u201220 \u00b0C (for at least 2 hr)<\/li>\n
                                8. After precipitation, pellet RNA<\/span> by spinning at 4 \u00b0C, 25 min<\/li>\n
                                9. Remove all ethanol, air-dry pellet for 5 min and resuspend pellet in H2O<\/li>\n<\/ol>\n

                                  Phenol\/chloroform extraction <\/strong><\/p>\n

                                  To each sample RNA<\/span>:<\/p>\n

                                    \n
                                  1. Add equal volume of phenol (at appropriate pH<\/span>), vortex for 1 min<\/li>\n
                                  2. Centrifuge at 4 \u00b0C for 10 min<\/li>\n
                                  3. Remove aqueous phase carefully to fresh tube<\/li>\n
                                  4. Add equal volume of chloroform, vortex for 1 min<\/li>\n
                                  5. Centrifuge at 4 \u00b0C for 10 min<\/li>\n
                                  6. Remove aqueous phase carefully to fresh tube<\/li>\n
                                  7. Add 0.1x vol NaOAc (3 M, pH<\/span> 5.2), 2.5x 100% EtOH, GlycoBlue<\/li>\n
                                  8. Precipitate at \u201220 \u00b0C (for at least 2 hr)<\/li>\n
                                  9. After precipitation, pellet RNA<\/span> by spinning at 4 \u00b0C, 25 min<\/li>\n
                                  10. Remove all ethanol, air-dry pellet for 5 min and resuspend pellet in H2O<\/li>\n<\/ol>\n

                                    Ribosome Profiling \u2013 ribosome footprinting <\/strong><\/h3>\n

                                    Estimate of number of cells required<\/strong><\/h3>\n

                                    Ribosome<\/span> profiling: This varies depending on cell type\/size, but as an example, I usually use ~10 million HeLa cells per sucrose gradient<\/p>\n

                                    Gradient preparation <\/strong><\/h3>\n

                                    Gradients are prepared by horizontal diffusion for a few hours at 4 \u00b0C. Therefore, this is done the DAY BEFORE the gradients need to be used.<\/p>\n

                                      \n
                                    1. Prepare 10% and 50% gradient buffers by adding DTT (2 mM) and CHX (100 \u03bcg\/ml) fresh<\/li>\n
                                    2. Pipette 5.4 ml 10% gradient buffer into polyallomer tube.<\/li>\n
                                    3. Underlay 5.4 ml 50% gradient buffer using a 21-gauge, 2-inch needle<\/li>\n
                                    4. Seal top of tube with parafilm<\/li>\n
                                    5. Gently tilt tube to horizontal position and leave in cold room for 6.5 hrs to set up the linear gradient by horizontal diffusion.<\/li>\n
                                    6. After 6.5 hrs, tilt tube slowly back to vertical position<\/li>\n
                                    7. Leave in cold room till usage the next day, gradient formed will be stable till then<\/li>\n<\/ol>\n

                                      Harvesting of cells\/biological material <\/strong><\/h3>\n

                                      The example below is written for cells grown in monolayer culture.<\/p>\n

                                      (e.g. untransfected HeLa cells)<\/p>\n

                                      Day before:<\/p>\n

                                      Split cells such that dish will be 70-80% confluent on day of harvesting<\/p>\n

                                      Day of harvesting:<\/p>\n

                                      Arrest translation with cycloheximide (CHX):<\/p>\n

                                        \n
                                      1. Spike medium that cells are growing in with CHX (final 100 \u03bcg\/ml, therefore NOTE the volume of media in the dish\/container beforehand!)<\/li>\n
                                      2. Return cells to 37 \u00b0C for 10 min<\/li>\n<\/ol>\n

                                        Harvesting cells <\/strong><\/h3>\n
                                          \n
                                        1. Transport cells to cold room<\/li>\n
                                        2. Remove media on ice<\/li>\n
                                        3. Wash 2x with ice-cold PBS (+100 \u03bcg\/ml CHX)<\/li>\n
                                        4. Lyse with 1 ml lysis buffer<\/span> (e.g. for one 15-cm dish) \uf0e0 for each plate, turn the dish to make sure that the lysis buffer<\/span> covers every part of the dish at some point<\/li>\n
                                        5. Scrape cells off the dish, collect into eppendorf tube<\/li>\n
                                        6. Shear 4x with 26-gauge needle, VERY gently<\/li>\n
                                        7. Centrifuge at 1300 x g for 10 min<\/li>\n
                                        8. Remove supernatant to fresh tube<\/li>\n<\/ol>\n

                                          (At this point, lysates can be snap-frozen in liquid nitrogen and stored at \u201280 \u00b0C, for processing at a later date)<\/p>\n

                                          Proceed as follows if samples had been snap-frozen:<\/p>\n

                                            \n
                                          1. Thaw frozen samples on ice in the cold room (for 1 ml volume, this should take ~2 hrs)<\/li>\n<\/ol>\n

                                            Nuclease digestion <\/em><\/strong><\/h3>\n

                                            To fresh lysate, or snap-frozen lysate that has been thawed:<\/p>\n

                                              \n
                                            1. Add RNase I (0.5\u20121 U\/\u03bcl lysate)<\/li>\n
                                            2. Incubate at room temperature for 30 min, with gentle shaking\/rotation<\/li>\n
                                            3. After digest, place tube on ice and load straight onto gradient<\/li>\n<\/ol>\n

                                              Centrifugation <\/em><\/strong><\/h3>\n

                                              Centrifuge should be switched on 30-45 min PRIOR to usage, for pre-chilling to 4 \u00b0C<\/p>\n

                                                \n
                                              1. Layer ~800 \u03bcl of digested extract onto 11-ml 10\u201250% linear sucrose gradient<\/li>\n
                                              2. WEIGH AND BALANCE CAREFULLY (with remaining extract, or lysis buffer<\/span>)<\/li>\n
                                              3. Centrifuge in SW-41 Ti rotor, 36,000 rpm for 2 hr, at 4 \u00b0C, acceleration mark \u20181\u2019, deceleration mark \u20187\u2019<\/li>\n
                                              4. After centrifugation<\/span> (when the rotor has come to a complete stop), do NOT retrieve samples immediately wait at least 5 min before doing so, otherwise it will be difficult to remove tubes from swinging buckets<\/li>\n<\/ol>\n

                                                Fraction collection <\/em><\/strong><\/h3>\n
                                                  \n
                                                1. Set baseline with ~3 ml 10% gradient buffer<\/li>\n
                                                2. Set up 15-ml Falcon tubes with parafilm and 2-ml microcentrifuge screw cap tubes<\/li>\n
                                                3. Remove sample tube from swinging bucket carefully with forceps, try not to touch sample<\/li>\n
                                                4. Fix tube to fractionator<\/li>\n
                                                5. Collect fractions by upward displacement with 60% sucrose (spiked with bromophenol blue for easy visualization of displacement front)<\/li>\n
                                                6. Place collected fractions on ice, till all gradients are fractionated<\/li>\n
                                                7. WASH with ~3 ml H2O in between gradients<\/li>\n
                                                8. WASH with AT LEAST 3x 50 ml H2O after all collection done<\/li>\n<\/ol>\n

                                                  Settings <\/strong><\/h3>\n

                                                  Sensitivity: 0.2<\/p>\n

                                                  Pump speed: 0.75 ml\/min<\/p>\n

                                                  Chart recorder speed: 60 cm\/hr<\/p>\n

                                                  At this speed, should get 15 fractions of ~750 \u03bcl each per gradient<\/p>\n

                                                  Release\/filtration<\/p>\n

                                                  The rationale behind the steps in this section is reduce ribosomal RNA<\/span> contamination by making use of EDTA to separate the ribosomal subunits, thus releasing the mRNA fragments, after which a 100 kDa membrane filter is used to trap the ribosomal subunits and any non-covalently associated ribosomal RNA<\/span> fragment. However, we are not sure how effective this step is in reducing the rRNA contamination \u2013 even with this step, rRNA contamination can still range from 50% to >90%. As we found that the contaminants tend to come from a few locations in the ribosomal RNA<\/span> sequences, we are currently trying to use subtractive hybridization to remove major contaminants during the library generation process, instead of performing this release\/filtration step.<\/p>\n

                                                  Pool monosome fractions (usually two fractions) for each gradient and:<\/p>\n

                                                    \n
                                                  1. Load onto Ultra-4 centrifugal filters with Ultracel-100 membranes<\/li>\n
                                                  2. Centrifuge at 1900 x g for 30 min at 4 \u00b0C to concentrate sample<\/li>\n
                                                  3. Add 1220 \u03bcl ice-cold release buffer to the retentate (should get ~100 \u03bcl retentate after centrifugation<\/span>)<\/li>\n
                                                  4. Incubate 10 min on ice<\/li>\n
                                                  5. Transfer filter unit to new 15-ml falcon tube and centrifuge at 1900 x g for 15 min at 4 \u00b0C<\/li>\n
                                                  6. Separate the release filtrate into two equal-volume aliquots and proceed to proteinase K digest<\/li>\n<\/ol>\n

                                                    Proteinase K\/SDS digest <\/strong><\/h3>\n

                                                    The following steps can be applied to the release filtrate, or to the collected fractions.<\/p>\n

                                                    To each release filtrate aliquot\/fraction:<\/p>\n

                                                      \n
                                                    1. Add x \u03bcl 10% SDS (to final 1%)<\/li>\n
                                                    2. Add y \u03bcl proteinase K (to final 200 \u03bcg\/ml)<\/li>\n
                                                    3. Invert to mix<\/li>\n
                                                    4. Incubate at 42 \u00b0C, 30 min<\/li>\n<\/ol>\n

                                                      Phenol\/chloroform extraction <\/strong><\/h3>\n

                                                      To each proteinase K-digested fraction:<\/p>\n

                                                        \n
                                                      1. Add equal volume of acid phenol, pH<\/span> 4.5, and phenol\/chloroform extract<\/li>\n
                                                      2. To final aqueous phase, add 0.1x vol NaOAc (3 M, pH<\/span> 5.2), 2.5x vol 100% EtOH, GlycoBlue precipitate<\/li>\n<\/ol>\n

                                                        Proceed to library generation<\/p>\n

                                                        Buffers <\/strong><\/h3>\n
                                                          \n
                                                        1. 10% or 50% gradient buffer for sucrose gradients<\/li>\n<\/ol>\n

                                                          20 mM HEPES-KOH (pH<\/span> 7.4)<\/p>\n

                                                          5 mM MgCl2<\/p>\n

                                                          100 mM KCl<\/p>\n

                                                          Either 10% or 50% sucrose (w\/v)<\/p>\n

                                                          Filter-sterilize, store at 4 \u00b0C<\/p>\n

                                                          Add fresh just before pouring:<\/p>\n

                                                          2 mM DTT<\/p>\n

                                                          100 \u03bcg\/ml cycloheximide<\/p>\n

                                                          20 U\/ml SUPERase\u2022In<\/p>\n

                                                            \n
                                                          1. 60% (w\/v) sucrose displacement solution (spiked with bromophenol blue) <\/em><\/strong><\/li>\n<\/ol>\n

                                                            Filter-sterilize, store at 4 \u00b0C<\/p>\n

                                                              \n
                                                            1. Lysis buffer<\/span> <\/em><\/strong><\/li>\n<\/ol>\n

                                                              10 mM Tris-HCl (pH<\/span> 7.4)<\/p>\n

                                                              5 mM MgCl2<\/p>\n

                                                              100 mM KCl<\/p>\n

                                                              1% Triton X-100<\/p>\n

                                                              Filter-sterilize, store at 4 \u00b0C<\/p>\n

                                                              Add fresh before use: <\/em><\/strong><\/p>\n

                                                              2 mM DTT<\/p>\n

                                                              500 U\/ml RNasin<\/p>\n

                                                              100 \u03bcg\/ml cycloheximide<\/p>\n

                                                              Protease inhibitor<\/span> (1X complete, EDTA-free)<\/p>\n

                                                                \n
                                                              1. PBS (supplemented with 100 \u03bcg\/ml CHX) \u2013 make fresh <\/em><\/strong><\/li>\n
                                                              2. Release buffer <\/em><\/strong><\/li>\n<\/ol>\n

                                                                20 mM HEPES-KOH (pH<\/span> 7.4)<\/p>\n

                                                                100 mM KCl<\/p>\n

                                                                1 mM EDTA<\/p>\n

                                                                Add fresh before use:<\/p>\n

                                                                2 mM DTT<\/p>\n

                                                                20 U\/ml SUPERase\u2022In<\/p>\n","protected":false},"excerpt":{"rendered":"

                                                                In this article two protocols have been described. The first protocol is for combined m-RNA and ribosome profiling. Since most of the biological procedures requires both of them done at same time. Second procedure is for the profiling of ribosome only. Harvesting cells for parallel mRNA-Seq and ribosome profiling Harvesting of cells\/biological material The example […]<\/p>\n","protected":false},"author":2,"featured_media":0,"parent":401,"menu_order":0,"comment_status":"closed","ping_status":"closed","template":"","meta":{"_et_pb_use_builder":"","_et_pb_old_content":"","_et_gb_content_width":"","footnotes":""},"class_list":["post-1684","page","type-page","status-publish","hentry"],"_links":{"self":[{"href":"https:\/\/www.mybiosource.com\/learn\/wp-json\/wp\/v2\/pages\/1684","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/www.mybiosource.com\/learn\/wp-json\/wp\/v2\/pages"}],"about":[{"href":"https:\/\/www.mybiosource.com\/learn\/wp-json\/wp\/v2\/types\/page"}],"author":[{"embeddable":true,"href":"https:\/\/www.mybiosource.com\/learn\/wp-json\/wp\/v2\/users\/2"}],"replies":[{"embeddable":true,"href":"https:\/\/www.mybiosource.com\/learn\/wp-json\/wp\/v2\/comments?post=1684"}],"version-history":[{"count":0,"href":"https:\/\/www.mybiosource.com\/learn\/wp-json\/wp\/v2\/pages\/1684\/revisions"}],"up":[{"embeddable":true,"href":"https:\/\/www.mybiosource.com\/learn\/wp-json\/wp\/v2\/pages\/401"}],"wp:attachment":[{"href":"https:\/\/www.mybiosource.com\/learn\/wp-json\/wp\/v2\/media?parent=1684"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}