Ribosome Profiling

In this article two protocols have been described. The first protocol is for combined m-RNA and ribosome profiling. Since most of the biological procedures requires both of them done at same time. Second procedure is for the profiling of ribosome only.

Harvesting cells for parallel mRNA-Seq and ribosome profiling

Harvesting of cells/biological material

The example below is written for cells grown in monolayer culture. Estimate of number of cells required:

mRNA-Seq: Use enough cells to get ~15-20 μg total RNA

Ribosome profiling: This varies depending on cell type/size, but as an example, use ~10 million HeLa cells per sucrose gradient

Day before:

Split cells such that dish will be 70-80% confluent on day of harvesting.

Day of harvesting

Arrest translation with cycloheximide (CHX)

1. Spike medium that cells are growing in with CHX (final 100 μg/ml, therefore NOTE the volume of media in the dish/container beforehand!)
2. Return cells to 37 °C for 10 min.

Harvesting cells

1. Transport cells to cold room.
2. Remove media on ice.
3. Wash 2x with ice-cold PBS (+100 μg/ml CHX).
4. Scrape cells off culture dish in PBS (+100 μg/ml CHX).
5. Transfer to eppendorf tube and divide cell suspension into separate portions for mRNA-Seq and ribosome profiling accordingly.
6. Centrifuge at 330 x g for 5 min to pellet cells.
7. Remove supernatant.
8. (a) Extract total RNA with TRI reagent (done according to manufacturer’s instructions)
9. (b) To cell pellet used for ribosome profiling: lyse cells with 1 ml lysis buffer. Shear 4x with 26-gauge needle, very gently.

Library generation – for mRNA-Seq and ribosome profiling

Size selection

Ribosome profiling

Ribosome-protected fragments (RPFs) are usually ~30 nt in length. Previous runs have indicated that the main contaminating rRNA fragments are at ~26 nt and ~35 nt. Thus it is recommended to use 26-mer and 32-mer RNA marker oligos (these would be 27 nt and 33 nt after pCp labeling) to follow the entire library generation process.

mRNA-Seq

Run labeled markers alongside the samples to estimate the size range to cut.

Decade marker labeling

Markers according to manufacturer’s instructions

pCp labeling of marker oligos (26-mer, 32-mer)

After overnight ligation,

1. Add 20 μl 2x loading dye to ligation reaction
2. Gel-purify, elute overnight in 0.3 M NaCl, precipitate eluted RNA with GlycoBlue

Size selection by denaturing polyacrylamide gel

For each sample RNA (resuspended in H2O):

1. Add 10 K count (in total) of 26-mer and 32-mer labeled marker oligos (now 27 bases and 33 bases long respectively)
2. Add 2x loading dye
3. Run on 10% urea-polyacrylamide gel, till dye front just about reached bottom of gel.
4. For RPFs: Cut out 27‒33 nt, make the cut tightly around the labeled markers.
5. For mRNA-Seq fragments: Based on the labeled Decade markers, cut out a 20-base size range (e.g. I have done 25‒45 nt, and 35‒55 nt)
6. Elute overnight in 0.3 M NaCl  precipitate RNA with GlycoBlue

NOTE: It is important to make the cut TIGHTLY around the RPFs to exclude as much of the flanking rRNA fragments as possible. If this cut is not tight enough, it results in in high levels of rRNA contamination (60‒93%) in the initial RPF libraries.

Dephosphorylation

Resuspend RNA pellet (after size selection) in H₂O

–> 37 °C, 6 hr

After 6-hr incubation, to each dephosphorylation reaction:

1. Add 5 μl H2O to top up to 30 μl
2. Desalt with G-25 microspin column
3. Top up to 400 μl with H2O
4. Add equal volume of phenol pH 8.0, and phenol/chloroform extract
5. To final aqueous phase, add 0.1x vol NaOAc (3 M, pH 5.2), 2.5x vol 100% EtOH, GlycoBlue  precipitate

Ligation

Resuspend RNA pellet (after 3′ dephosphorylation) in H2O

–> 22 °C, 2.5 hr

NOTE: Do NOT use the T4 ligation buffer from NEB, which contains ATP

To each ligation reaction:

1. Add 2x loading dye
2. Gel-purify on 10% urea-polyacrylamide gel, cut out expected size range (+ 21 nt to original size-selected fragments), using marker oligos and/or Decade markers as guide
3. Elute overnight à precipitate RNA with GlycoBlue

Phosphorylation

Resuspend RNA pellet (after 3′ ligation) in H2O

–> 37 °C, 30 min

After 30 min incubation, to each 5′ phosphorylation reaction:

1. Add 16 μl H2O to top up to 30 μl
2. Desalt with G-25 microspin column
3. Top up to 400 μl with H2O
4. Add equal volume of phenol pH 8.0, and phenol/chloroform extract
5. To final aqueous phase, add 0.1x vol NaOAc (3 M, pH 5.2), 2.5x vol 100% EtOH, GlycoBlue à precipitate

Ligation

Resuspend RNA pellet (after 5′ phosphorylation) in H2O

–> 22 °C, 18 hr

To each ligation reaction:

1. Add 2x loading dye
2. Gel-purify on 10% urea-polyacrylamide gel, cut out expected size range (+ 26 nt to the size range after 3′ ligation), using marker oligos and/or markers as guide
3. Elute overnight à precipitate RNA with GlycoBlue

4.6 Reverse transcription/Splicing by Overlap Extension PCR (SOE-PCR)

This part of the protocol largely follows the analogous section in the Bartel lab small RNA cloning protocol.

Reverse transcription

Resuspend RNA pellet (after 5′ ligation) in H2O

–> 48 °C, 3 min

To each tube:

1. Remove 3 μl for RT-minus control
2. Add 1 μl SuperScript II (200 U, Invitrogen) to RT-plus reaction

–>44 °C, 1 hr

3. Hydrolyze RNA template by adding 1 M NaOH

–>90 °C, 10 min

4. Add 1 M HEPES-NaOH (pH 7.0) to neutralize

5. Desalt with G-25 microspin column
6. Proceed straight to SOE-PCR or store at ‒20 °C

SOE-PCR1 (to allow for extension)

àSplit RT-plus into 2 tubes of 49 μl each

The PCR cycle is as follows at 98oC  for 30 sec, at 94oC for 30 sec , at 60oC for 30 sec, at 72oC for 15 sec, at 72 oC for 10 minutes , at 10oC for an indefinite time. Repeat 3 more times.

 SOE-PCR2 (for amplification)

To each tube of PCR reaction, add:

The PCR cycle is as follows at 98⁰C  for 30 sec, at 94⁰C for 30 sec , at 60⁰C for 30 sec, at 72⁰C for 15 sec, at 72⁰C for 10 min , at 10⁰C for infinite time. For 18 cycles in total.

Ethanol-precipitate each PCR reaction without GlycoBlue

Formamide gel purification and sample submission

1. Resuspend each DNA pellet in 15 μl 1x formamide loading dye
2. Prepare 10 nt ladder: 2 μl 10 bp DNA marker (diluted to 0.1 μg/μl, Invitrogen) in 13 μl 1x formamide loading dye
3. Heat samples and marker for 10 min at 85 °C and gel-purify on 90% formamide, 8% acrylamide gel
4. Stain with SYBR Gold (Invitrogen) (5 μl/50 ml 1X TBE )
5. Cut and elute band at ~100 nt for ribosome profiling samples. mRNA-Seq samples will run slightly higher, depending on the initial size-selection (RT-minus sample will run at ~44 nt).
6. Ethanol-precipitate without adding GlycoBlue.
7. After precipitation, remove ethanol, wash once with 70% ethanol
8. Let dry for 10 min with cap open, and another 20 min with cap closed (but poke hole in cap)
9. Resuspend in 10 μl 10 mM Tris (EB) and submit sample for sequencing

Buffers

1. 1.5x MES-NaOH buffer

150 mM MES-NaOH, pH 5.5

15 mM MgCl2

15 mM β-mercaptoethanol

450 mM NaCl

Store at ‒20 °C

2. 10x T4 ligation buffer

500 mM Tris-HCl, pH 7.8

100 mM MgCl2

100 mM DTT

Store at ‒20 °C

Oligo’s used

>26-mer marker oligo

5′ AGCGUGUACUCCGAAGAGGAUCCAAA 3′

>32-mer marker oligo

5′ GGCAUUAACGCGAACUCGGCCUACAAUAGUGA 3′

>3′ adenylated adaptor (21.340x)

5′ AppTCGTATGCCGTCTTCTGCTTGidT 3′

>5′ adaptor (26.71)

5′ GUUCAGAGUUCUACAGUCCGACGAUC 3′

>RT primer/5′ PCR primer (18.206)

5′ CAAGCAGAAGACGGCATA 3′

>3′ PCR primer (44.45)

5′ AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA 3′

>Sequencing primer used on Solexa flow cell (underlined in final contruct)

5′ CGACAGGTTCAGAGTTCTACAGTCCGACGATC 3′

Final construct:

5′ AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACGATCNNNNNNNNNNNNNTCGTATGCCGTCTTCTGCTTG 3′

3′ TTACTATGCCGCTGGTGGCTGTCCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNNNNNNNAGCATACGGCAGAAGACGAAC 5′

For formulation

Miscellaneous procedures

Gel purification

To each sample RNA:

1. Add 2x loading dye
2. Heat to 90 °C for 5 min
3. Run on a 10% denaturing polyacrylamide gel until dye front about ~1 inch from bottom
4. Cut out gel piece containing RNA of desired size range
5. Elute RNA from the gel piece by adding 440 μl 0.3 M NaCl, and rotating the tube at 4 °C overnight
6. (Next day) Remove supernatant (~400 μl) and add 1 ml 100% ethanol (optional: add GlycoBlue to help visualize RNA pellet after precipitation
7. Precipitate at ‒20 °C (for at least 2 hr)
8. After precipitation, pellet RNA by spinning at 4 °C, 25 min
9. Remove all ethanol, air-dry pellet for 5 min and resuspend pellet in H2O

Phenol/chloroform extraction

To each sample RNA:

1. Add equal volume of phenol (at appropriate pH), vortex for 1 min
2. Centrifuge at 4 °C for 10 min
3. Remove aqueous phase carefully to fresh tube
4. Add equal volume of chloroform, vortex for 1 min
5. Centrifuge at 4 °C for 10 min
6. Remove aqueous phase carefully to fresh tube
7. Add 0.1x vol NaOAc (3 M, pH 5.2), 2.5x 100% EtOH, GlycoBlue
8. Precipitate at ‒20 °C (for at least 2 hr)
9. After precipitation, pellet RNA by spinning at 4 °C, 25 min
10. Remove all ethanol, air-dry pellet for 5 min and resuspend pellet in H2O

Ribosome Profiling – ribosome footprinting

Estimate of number of cells required

Ribosome profiling: This varies depending on cell type/size, but as an example, I usually use ~10 million HeLa cells per sucrose gradient

Gradient preparation

Gradients are prepared by horizontal diffusion for a few hours at 4 °C. Therefore, this is done the DAY BEFORE the gradients need to be used.

1. Prepare 10% and 50% gradient buffers by adding DTT (2 mM) and CHX (100 μg/ml) fresh
2. Pipette 5.4 ml 10% gradient buffer into polyallomer tube.
3. Underlay 5.4 ml 50% gradient buffer using a 21-gauge, 2-inch needle
4. Seal top of tube with parafilm
5. Gently tilt tube to horizontal position and leave in cold room for 6.5 hrs to set up the linear gradient by horizontal diffusion.
6. After 6.5 hrs, tilt tube slowly back to vertical position
7. Leave in cold room till usage the next day, gradient formed will be stable till then

Harvesting of cells/biological material

The example below is written for cells grown in monolayer culture.

(e.g. untransfected HeLa cells)

Day before:

Split cells such that dish will be 70-80% confluent on day of harvesting

Day of harvesting:

Arrest translation with cycloheximide (CHX):

1. Spike medium that cells are growing in with CHX (final 100 μg/ml, therefore NOTE the volume of media in the dish/container beforehand!)
2. Return cells to 37 °C for 10 min

Harvesting cells

1. Transport cells to cold room
2. Remove media on ice
3. Wash 2x with ice-cold PBS (+100 μg/ml CHX)
4. Lyse with 1 ml lysis buffer (e.g. for one 15-cm dish)  for each plate, turn the dish to make sure that the lysis buffer covers every part of the dish at some point
5. Scrape cells off the dish, collect into eppendorf tube
6. Shear 4x with 26-gauge needle, VERY gently
7. Centrifuge at 1300 x g for 10 min
8. Remove supernatant to fresh tube

(At this point, lysates can be snap-frozen in liquid nitrogen and stored at ‒80 °C, for processing at a later date)

Proceed as follows if samples had been snap-frozen:

1. Thaw frozen samples on ice in the cold room (for 1 ml volume, this should take ~2 hrs)

Nuclease digestion

To fresh lysate, or snap-frozen lysate that has been thawed:

1. Add RNase I (0.5‒1 U/μl lysate)
2. Incubate at room temperature for 30 min, with gentle shaking/rotation
3. After digest, place tube on ice and load straight onto gradient

Centrifugation

Centrifuge should be switched on 30-45 min PRIOR to usage, for pre-chilling to 4 °C

1. Layer ~800 μl of digested extract onto 11-ml 10‒50% linear sucrose gradient
2. WEIGH AND BALANCE CAREFULLY (with remaining extract, or lysis buffer)
3. Centrifuge in SW-41 Ti rotor, 36,000 rpm for 2 hr, at 4 °C, acceleration mark ‘1’, deceleration mark ‘7’
4. After centrifugation (when the rotor has come to a complete stop), do NOT retrieve samples immediately wait at least 5 min before doing so, otherwise it will be difficult to remove tubes from swinging buckets

Fraction collection

1. Set baseline with ~3 ml 10% gradient buffer
2. Set up 15-ml Falcon tubes with parafilm and 2-ml microcentrifuge screw cap tubes
3. Remove sample tube from swinging bucket carefully with forceps, try not to touch sample
4. Fix tube to fractionator
5. Collect fractions by upward displacement with 60% sucrose (spiked with bromophenol blue for easy visualization of displacement front)
6. Place collected fractions on ice, till all gradients are fractionated
7. WASH with ~3 ml H2O in between gradients
8. WASH with AT LEAST 3x 50 ml H2O after all collection done

Settings

Sensitivity: 0.2

Pump speed: 0.75 ml/min

Chart recorder speed: 60 cm/hr

At this speed, should get 15 fractions of ~750 μl each per gradient

Release/filtration

The rationale behind the steps in this section is reduce ribosomal RNA contamination by making use of EDTA to separate the ribosomal subunits, thus releasing the mRNA fragments, after which a 100 kDa membrane filter is used to trap the ribosomal subunits and any non-covalently associated ribosomal RNA fragment. However, we are not sure how effective this step is in reducing the rRNA contamination – even with this step, rRNA contamination can still range from 50% to >90%. As we found that the contaminants tend to come from a few locations in the ribosomal RNA sequences, we are currently trying to use subtractive hybridization to remove major contaminants during the library generation process, instead of performing this release/filtration step.

Pool monosome fractions (usually two fractions) for each gradient and:

1. Load onto Ultra-4 centrifugal filters with Ultracel-100 membranes
2. Centrifuge at 1900 x g for 30 min at 4 °C to concentrate sample
3. Add 1220 μl ice-cold release buffer to the retentate (should get ~100 μl retentate after centrifugation)
4. Incubate 10 min on ice
5. Transfer filter unit to new 15-ml falcon tube and centrifuge at 1900 x g for 15 min at 4 °C
6. Separate the release filtrate into two equal-volume aliquots and proceed to proteinase K digest

Proteinase K/SDS digest

The following steps can be applied to the release filtrate, or to the collected fractions.

To each release filtrate aliquot/fraction:

1. Add x μl 10% SDS (to final 1%)
2. Add y μl proteinase K (to final 200 μg/ml)
3. Invert to mix
4. Incubate at 42 °C, 30 min

Phenol/chloroform extraction

To each proteinase K-digested fraction:

1. Add equal volume of acid phenol, pH 4.5, and phenol/chloroform extract
2. To final aqueous phase, add 0.1x vol NaOAc (3 M, pH 5.2), 2.5x vol 100% EtOH, GlycoBlue precipitate

Proceed to library generation

Buffers

1. 10% or 50% gradient buffer for sucrose gradients

20 mM HEPES-KOH (pH 7.4)

5 mM MgCl2

100 mM KCl

Either 10% or 50% sucrose (w/v)

Filter-sterilize, store at 4 °C

Add fresh just before pouring:

2 mM DTT

100 μg/ml cycloheximide

20 U/ml SUPERase•In

2. 60% (w/v) sucrose displacement solution (spiked with bromophenol blue)

Filter-sterilize, store at 4 °C

3. Lysis buffer

10 mM Tris-HCl (pH 7.4)

5 mM MgCl2

100 mM KCl

1% Triton X-100

Filter-sterilize, store at 4 °C

Add fresh before use:

2 mM DTT

500 U/ml RNasin

100 μg/ml cycloheximide

Protease inhibitor (1X complete, EDTA-free)

4. PBS (supplemented with 100 μg/ml CHX) – make fresh
5. Release buffer

20 mM HEPES-KOH (pH 7.4)

100 mM KCl

1 mM EDTA

Add fresh before use:

2 mM DTT

20 U/ml SUPERase•In